Introduction
The
Ganoderma fungi are responsible for considerable yield losses in oil palm (Elaeis
guineensis), coconut (Cocos nucifera), rubber (Hevea Brasiliensis)
and palmyra palm (Borassus flabellifer) (Chee 2005; Sankaran et al. 2005; Kandan et al. 2010; Bejo and Vong 2014). Initially, Ganoderma disease had
been thought to be caused by the Ganoderma boninense alone; however, in
recent studies, several species have been reported to be responsible for the
basal stem rot disease in oil palm trees, namely, G. zonatum, G. boninense,
G. sinense and G. miniatocinctum (Zhao et al. 2007; Rashid et al.
2014). G. lucidum and G. applanatum were the most aggressive
pathogen that caused the basal stem rot in coconut trees (Bhaskaran 2000;
Rajendran et al. 2009). G.
boninense also occurs on coconut trees, reportedly due to a saprophyte
(Pilotti et al. 2004). On the other
hand, G. pseudoferreum and G. philiplii are the most common
species to infect rubber trees (Zakaria et
al. 2009; Ogbebor et al. 2010).
Pilotti (2005) reported the physiological
characteristics of the G. boninense causing basal stem rot in the oil
palm. The genetic diversity of G. boninense has been reported based on
species diversity and genetic heterogeneity in oil palm (Miller et al. 1999; Pilotti et al. 2003). The basidiospores of G.
boninense implicated in distribution and genetic diversity have been found
to cause basal stem rot (BSR) and upper stem rot (USR) (Rees et al. 2012). In particular, the
availability of new molecular biology tools has made it possible to develop a
large number of genetic markers. Microsatellites marker remains the most widely
and powerful used tool for studying population genetics and the geographical
spread of plant pathogens (Schoebel et
al. 2013a, b). Purba et al.
(2019) have reported thirteen species of G. boninense in oil palm in
Indonesia, which they discovered through a sequence analysis. Moreover,
Hapuarachchi et al. (2019) also
reported twenty species of G. sinense in China found through sequence
analysis.
Furthermore, the bioinformatics method provided more
information on genetics (Pop and Salzberg 2008; Horner et al. 2009). G. boninense has a role in the
diversity and the physical and chemical characteristics that are
distinguishable by amino acids (Basyuni et
al. 2018a). Moreover, Zhu et al.
(2015) have reported more than 30 genes of a cluster of G. sinense, which they classified using the
bioinformatics approach. This study extended our previous work and aimed to
determine the genetic diversity within G. Boninense populations in some
palm trees through sequence analysis and the bioinformatics method.
Materials ad Methods
Sample collection
A total of
49 isolates of the Ganoderma sp. belong to Socfindo derived from C. nucifera (3), H.
brasiliensis (6), E. guineensis (37), and B. flabellifer (3)
were collected in some parts of Indonesia (Fig. 1), as follows: Bah-Lias, Simalungun
(SL) 3°15' N 99°18' E, Faculty Agricultural University Sumatera Utara (FA) 3°33'
N 98˚ 39' E, Gambus Land-Batu Bara (GL) 3°09' N 99°26' E,
Sirandorung-Central Tapanuli (CP) 2°02' N 98°21' E, South Sulawesi (SSul) 8°32'
S 120°11' E, Dolok-Batu Bara (DB) 3°12' N 99°29' E, Bangun Bandar-Serdang
Bedagai (BB) 3°15' N 99°41' E, Sei Dadap-Asahan (SD) 2°57' N 99°41' E, North
Labuhan Batu (LB) 2°28' N 99°53' E, and South Sumatera (SSum) 3°19' S 104°00'
E.
Growth of G.
boninense in the PDA
The fungi
were maintained on Potato Dextrose Agar
(PDA) and the mycelial growth for a minimum of ten days’ subculture (Nasreen et al. 2005).
DNA extraction
Total DNA was extracted using cetyl
trimethyl ammonium bromide (CTAB) method (Brandfass and Karlovsky 2008). The
quantity DNA test was carried out following the nanophotometer method
(Gallagher and Desjardins 2006) and the quality test with agarose gel (1–2%)
and quantified using the UV-Tex method (Lee et
al. 2012).
Polymerase chain
reaction
A set of
specific primers SSR selected is shown in Table 1 (Mercière et al. 2015). The amplification reaction
for the PCR product was performed in 10 μL
of a total volume containing 3 μL
of DNA templates mixed with 2.5 μL
Gotaq master, 0.5 μL primer
forward and 0.5 μL primer
reverse, and 3.5 μL ddH2O.
The amplification was operated for 35 cycles (30 sec at 95°C 30 sec at 60°C, 40
sec at 78°C) and after the final to extensions of 8 min at 72°C. The PCR
product was analyzed with the electrophoresis agarose gel stained with GelRed®
and visualized with Ultraviolet Translumination (Voytas 2000).
Microsatellite
analysis
The
polymorphism data for each population and locus was assessed by calculating the
mean for allele frequency correlations between individuals in the subpopulation
(Fis), allele frequency correlations between subpopulations (Fst), allele
frequencies in the population caused by both factors (Fit), the total of
migrant (Nm), the number of different alleles (N), the number of different
alleles frequency > 0.5% (Na), the number of active alleles (Ne) and the
Shannon of information Index (I).
The genetic polymorphism for each population and locus
was assessed by calculating the mean observed heterozygosity (Ho), expected
heterozygosity (He), and the fixation index (F) (Nei 1978). The polymorphic
information content (PIC) was determined by Avval (2017). Genetic structure
analyzed was calculated using the analysis of molecular variance (AMOVA)
package GenAlEx ver. 6.502 (Peakal and Smouse 2012).
DNA sequencing
analysis
The
polymerase chain reaction (PCR) products were purified and sequenced. The
nucleotides to confirm our microsatellite data were selected, and other
sequences, which are available in the NCBI database (https://blast.ncbi.nlm.nih.gov/)
at BLASTX program (Altschul et al.
1997), were searched for sequence similarity. The sequence of the comparable
database with BLASTX score were an E-value <10-4, considered to
have significant similarities (Bohnert et
al. 2001).
Physical
and chemical characteristics
The
structure and physico-chemical characteristics of selected data on G.
sinense were analyzed analysis with Protparam after an online search (web.expasy.org/protparam/).
The calculated factors designated of the length of genes, molecular weight,
theoretical isoelectric point values, total number of atoms, extinction
coefficients, half-life period, instability coefficient, aliphatic index, and
grand average of hydropathicity (Basyuni et
al. 2018b).
Possible peptide
transfer and subcellular localization
The transit
peptide of selected data on G. sinense was analyzed by accessing the
online P1.1 target server (www.cbs.dtu.dk/services/targetp/). This
position corresponds to the estimated presence of one of the chloroplast
pre-sequential N-terminal terminals of transit peptide (cTP), mitochondrial
targeting peptide (mTP), and also the peptide signal (SP) peptide pathway. The
prediction tool for subcellular localization proteins (PSORT) was used to
access online predictions with psort.hgc.jp/form.html to control the
protein-induced of subcellular determinations (Basyuni and Wati 2017).
Phylogenetic
analysis
Table 1: The primer
specific for G. boninense
|
Primer |
Primer Sequences (‘5-‘3) |
Amplification (bp) |
|
KT124397 |
F: CGCCATGCCCACCACCAGAG R: GACCCGGCTGCCCGAATGAG |
283-325 |
|
KT124403 |
F: GGCGACGAGGGCACGAGAGA R: CCGCACTTTCGCCAACCACC |
293-297 |
|
KT124399 |
F:
GCACAGGCACAAGCGCAAGG R:
CGACGACCGCCCCAAAGGAT |
204-267 |
|
KT124394 |
F: CGGGAAGTGGTGAACGGT R: GGGTGGCTTGACAGCGGCAT |
234-243 |
%20763-770_files/image002.jpg)
Fig. 1: Map of location of
Ganoderma sampling
Phylogenetic
analysis was done based on the location and grouping analysis of the
phylogenetic tree of G. boninense strains NJ3. To extend our knowledge
on the relationship of Ganoderma, a total of 12 locations and 49 samples were
selected. Furthermore, they were analyzed using the Unweighted Pair Group
Method with Arithmetic Mean (UPGMA) by MVSP ver. 3.22 software (Basyuni et al. 2018c). Fig. 2 was constructed
based on the length of the base pair nucleotide of the location Ganoderma
isolates. On the other hand, Fig. 3 was constructed based on the DNA sequences
that were obtained using the FASTA ver 3.4t26 software (Pearson and Lipman
1988) from the Bank of Japan Data DNA (Mishima, Shizuoka, Japan); this was
carried out by CLUSTAL W ver 1.83 program (Thompson et al. 1994) based on the neighbor-join method. The bootstrap
analysis with 1000 replications was used to assess the strength of nodes
(Felsenstein 1985).
Result
Genetic structure
Forty nine
samples were investigated for their locus (KT124397, KT124403, KT124399 and
KT124394), and the additional descriptions of microsatellite loci have reported
the success rate of the specific primers. After an interpretation of the
genetic variation and the interaction of locus frequency between alleles, the
mean of allele frequency in collaboration with individual alleles was found to
be 0.57. The mean frequencies of the entire Ganoderma
population differing in alleles were suspected to be Fit 0.66.
On the other hand, the test aimed at the relationship
between heterogeneity per locus. The summary of the genetic differentiation
between groups obtained was Fst 0.21. It has been suggested that the value
depends on the allele frequency at loci, and it exhibited a variety of
properties related to genetic diversity. The estimated number of migrants
obtained on average was Nm 0.97. The mean value of the polymorphic information
content (PIC) was 0.441, which was the lowest value of the polymorphism allele
on the loci KT124394 (0.172) and the loci KT124399 (0.372), while the other two
loci have PIC values more than 50% (Table 3).
The microsatellites observed in six populations showed
the value of alleles (N) to be 6.75 with differences in alleles in the
frequency of 5%. This was found to be 7.21 (Na), and the number of active
alleles (Ne) was found to be 6.38. The highest population variation index found
in basal stem rot, E. guineensis (BSR – EG), was 2.82 (I). Furthermore,
the lowest value in basal stem rot, H. brasiliensis (BSR – HB), was
1.03. This value was the same as the genetic diversity (He). The value of
heterozygosity (Ho) showed the number of genes or allele distribution in the
population and locus, and this value was lower than the expected heterozygosity
(He). The mean of Ho was found to be 0.75, higher than that of Ho 0.32. The
fixation index value in the upper stem rot, E. guineensis (USR – EG) was
found to be 0.92 (F), and the lowest value in the population of rubber wood
block (RWB) was found to be 0.19; however, the value of heterozygosity had
different comparisons (Table 2).
We observed statistically significant differences in
variation between individual isolates, and the expression differences between
individuals increased the variation. Molecular of variance analysis (AMOVA)
summarized based on the characteristics of the genetic diversity revealed 85%
among individuals and 15% within the individual (Table 4). It was not the
genetic diversity detection in the population.
Distribution
of the BLASTX
The BLASTX
of the 40 sequences analysis indicated previously as in G. boninense had
a closing similarity as Transcriptional factor proteins to G. sinense.
However, only eight sequences were identified as G. sinense strain
ZZ0214-1 (Table 5). The overall results of that species with varied
E-value ranges, and the total scores obtained and identified were 49.3–97.4 and
64–96%, respectively. The predictive approaches were other fungal proteins such
as hypothetical proteins for Hebeloma cylindrosporum, Stylophora pistillata,
Bostrobasidium botryosum, Aspergillus cristatus, Mixia osmundae,
Pseudogymnoascus sp, Lomentospora prolificans, Trametes versicolor, Trichoderma
gamsii, and Acidomyces richmondensis, with different strains.
However, an identified hypothetical protein, G. sinense, only had a
total score of 33.9 with a large E-value of seven despite identifying a 68% similarity.
On the other hand, the proteins were other sequences, including Alpha/Beta
hydrolase for Leucosporidium creatinivorum, Probable to GDP/GTP for Ustilago
hordei, Utp-14 domain for Trametes coccinea, putative glicyne-tRNA
ligase for Tolypocladium paradoxum, Neurexin-3b for Rhinocerous
sinocyclocheilus, and non-identity of sequence analysis for 11 samples.
%20763-770_files/image004.png)
Fig. 2: Cluster analysis of Ganoderma pathogen from 12 locations. BB
= Bangun Bandar
DB = Dolok-Batu Bara, CP = Central Tapanuli,
SSum = South Sumatera, SD = Sei Dadap-Asahan, LB = Labuhan Batu, GL = Gambus
Land, SL = Bah Lias Simalungun, SSul = South Sulawesi, FA = Faculty of
Agricultural USU. BF = Borassus
flabellifer, EG = Elaeis guineensis,
HB = Hevea brasiliensis, RWB = rubber
wood block
%20763-770_files/image006.png)
Fig. 3: Phylogenetic tree of Ganoderma
isolates. DNA sequences were collected by the neighbor-joining method, the
Clustel W, with scale indication corresponding to 0.1; the DNA sequences
substitution were per site and indicated bootstrap 1000 replicates. BF = Borassus
flabellifer, EG = Elaeis guineensis,
HB = Hevea brasiliensis, CN = Cocos nucifera. RWB =
rubber wood block. G. boninense data of sequence obtained from our previous research (Purba et al., 2019)
Physical
and chemical properties of the G. sinense
The
bioinformatics information of the Ganoderma sequence genes for G. sinense,
including several physical and chemical parameters are described in Table 6.
The database identified eight population sequences of G. sinense. It has
the value of the length from 252 – 264 bp. The molecular weight was shown in
the range of value 21,118 to 22,508. The theoretical isoelectric point values
were 5.09 to 5.24, suggesting it has a minor variation. B. flabellifer
(BF) and H. brasiliensis (HB) have a stable total number of atoms. The
highest extinction coefficient in E. guineensis (EG) was 6000, with the
smallest half-life period (1.2 h). Instability coefficient has been established
for isolates of G. sinense from 59.29 to 78.11. The aliphatic index EG
was significantly higher than that of BF, HB, CN, and RWB. The grand average of
hydropathicity was unstable from 0.900 to 1.085.
Potential transit
of peptide and subcellular localization of G. sinense
The DNA
spread into the chloroplast transit peptide (cTP) %20763-770_files/image007.png)
and
mitochondria transit peptide (mTP), was described in Table 7. Estimation of the
total number of different proteins occupant in the chloroplast varied among the
G. sinense of EG, RWB, and CN except BF and HB, which had a value of
0.119. Table 8 showed the most significant subcellular localization of G.
sinense found in the cytoplasm (Cyto) and mytochondria (Myto), wherein it
reported in Cyto 2.0 to 8.5 with Myto 2.0 to 6.0.
Phylogenetic
analysis
We
identified the genetic variation from six populations of BSR – CN (basal stem
rot – C. nucifera), BSR – BF (basal stem rot – B. flabellifer), BSR
– EG (basal stem rot – E. guineensis), USR – EG (upper stem rot –
E. guineensis), BSR – HB (basal stem rot – H. Brasiliensis) and
RWB (rubber wood block). It showed 12 locations in Fig. 2. The dendrogram
(UPGMA) showed two large groups in the population. The first group consisting
of location was Bangun Bandar and Dolok – Batu Bara. The second group consisted
mainly only eight sequences from Central Tapanuli, South Sumatra, Sei Dadap –
Asahan, Labuhan Batu, Gambus Land, Bah Lias – Simalungun, South Sulawesi and
the Faculty of Agriculture. To extend our knowledge of the relationship between
G. boninense and G. sinense, 13 sequences were used to draw the
dendrogram. Eight relationships of G. sinense (Rubber Wood Block,
E. guineensis, C. nucifera, H. brasiliensis, B.
flabellifer, C. nucifera) were selected to be displayed as a
dendrogram. Fig. 3 showed two large groups separated from G. boninense
strain NJ3 with original isolates from the E. guineensis, but G.
sinense strain ZZ0214-1 from various plant sources have a close genetic
diversity. They were identified as G. sinense scattered over two form
the same group.
Discussion
The genetic
analysis of the population structure of Indonesian species of Ganoderma supported the taxonomic
distinction among the isolates studied, and five distinct species were
identified. The allele of frequency can be classified according to the Buchert et al. (1997), which can be divided into
four categories. The alleles with a frequency of ≥ 0.75 at particular
loci were categorized as high, and alleles with a frequency of 0.75 > P ≥ 0.25 were categorized as
medium. The alleles of frequency 0.25 > P
≥ 0.01 were taken as low alleles and frequencies < 0.01 as rare
alleles.
On the other hand, according to Marshall and Brown
(1975), the alleles categorized were as general alleles if they had a frequency
≥ 0.05 and special alleles if the frequency was < 0.05. The population
and loci of Ganoderma have a mean frequency with value
0.54. According to Mercière et al.
(2015), and our SSR data for the PIC value showed high polymorphic information
content (PIC) with only two loci, KT124397 and KT12440. Both had a value of
0.61. The specific primers were capable of producing several alleles in several
genotypes in specific loci.
Table 5: Distribution of
the BLASTX for Ganoderma isolates of
sequence gene Accession
|
Accession |
Description |
Sequences |
Identify (%) |
Total score |
E-value |
|
PIL35715.1 |
Transcription factor (Ganoderma sinense ZZ0214-1) |
8 |
64-96 |
49.3-97.4 |
(1e-04)- (9e-23) |
|
KIM39402.1 |
Hypothetical protein M413DRAFT_29551 (Hebeloma cylindrosporum h7) |
1 |
62 |
33.5 |
2.5 |
|
ORY85318.1 |
Alpha/Beta hydrolase protein (Leucosporidium
creatinivorum) |
1 |
33 |
32 |
9.4 |
|
PFX24695.1 |
Hypothetical protein AWC38_SpisGene10691 (Stylophora pistillata) |
2 |
46 |
37.7 |
0.59-0.61 |
|
D05693.1 |
Hypothetical protein BOTBODRAFT_182311 (Botryobasidium botryosum FD-172SS1) |
1 |
35 |
118 |
9e-28 |
|
CCF48258.1 |
Probable to GDP/GTP exchange factor Rom2p (Ustilago hordei) |
1 |
55 |
32.3 |
6.8 |
|
SD00840.1 |
Utp14-domain-containing protein (Trametes
coccinea BRFM310) |
1 |
58 |
34.3 |
4.2 |
|
ODM20124.1 |
Hypothetical protein (Aspergillus
cristatus) |
1 |
33 |
35.8 |
1.7 |
|
XP_014568041.1 |
Hypothetical protein L969DRAFT_48519 (Mixia osmundae IAM 14324) |
1 |
32 |
35 |
2.7 |
|
PIL26871.1 |
Hypothetical protein GSI_11051 (Ganoderma
sinense ZZ0214-1) |
1 |
68 |
33.9 |
7 |
|
POR37917.1 |
Putative glycine tRNA ligase (Tolypocladium
paradoxum) |
1 |
71 |
58.2 |
2e-8 |
|
F47594.1 |
Hypothetical protein 495_01898 (Pseudogymnoascus
sp. M F 4514 FW-929) |
1 |
72 |
31.6 |
6.8 |
|
PKS09315.1 |
Hypothetical protein 003929 (Lemontospora
prolificans) |
1 |
54 |
34.7 |
4.5 |
|
XP_008042932.1 |
Hypothetical protein TRAVEDRAFT 74270 (Trametes versicolor FP 101664 SS1) |
1 |
40 |
32 |
8.1 |
|
XO_024400.1 |
Hypothetical protein TGAM01_v203499 (Trichoderma gamsii) |
1 |
51 |
35.4 |
6.9 |
|
XP_016393967.1 |
Neurexin-3b-like (Sinocyclocheilus
rhinocerous) |
1 |
46 |
36.6 |
3.9 |
|
KYG40648.1 |
Hypothetical protein M433DRAFT_160121 (Acidomyces richmondensis BFW) |
2 |
48 |
32 |
4.4 - 4.6 |
|
KFY47594.1 |
Hypothetical protein V495_01898 (Pseudogymnoascus
sp. VKM F-4514 FW-929) |
2 |
78 |
35-37 |
0.08 - 0.45 |
|
KYG406113.1 |
Hypothetical protein M433DRAFT_8635 (Acidomyces richmondensis BFW) |
1 |
48 |
32 |
4.4 |
|
UNKNOWN |
Not Detection |
11 |
nd |
nd |
nd |
Table 6: Physical and chemical properties of Ganoderma
sinense
|
Plant spesies |
BF |
EG |
HB |
RWB |
RWB |
RWB |
CN |
EG |
|
Length of genes/bp |
252 |
264 |
257 |
253 |
255 |
252 |
255 |
260 |
|
Molecular
weight |
21118 |
22508 |
21297 |
21357 |
21491 |
21206 |
21544 |
22037 |
|
Theoretical isoelectric point values |
5.24 |
5.22 |
5.23 |
5.24 |
5.22 |
5.24 |
5.21 |
5.09 |
|
Total number of atoms |
2582 |
2753 |
2582 |
2609 |
2619 |
2596 |
2612 |
2725 |
|
Extinction coefficient |
5500 |
6000 |
5875 |
5625 |
5750 |
5500 |
6125 |
5250 |
|
Half-life period |
4.4h |
1.2h |
4.4h |
4.4h |
1.2h |
4.4h |
1.2h |
7.2h |
|
Instability coefficient |
62.57 |
77.17 |
66.14 |
64.12 |
66.15 |
59.29 |
78.11 |
65.82 |
|
Aliphatic index |
21.83 |
21.59 |
20.62 |
20.55 |
18.43 |
21.83 |
20.78 |
19.62 |
|
Grand average of
hydropathicity |
1.054 |
1.085 |
1.074 |
1.042 |
0.998 |
1.052 |
1.126 |
0.900 |
BF = Borassus
flabellifer, EG = Elaeis guineensis, HB = Hevea brasiliensis,
RWB = rubber wood block, CN = Cocos
nucifera
The genetic diversity of the G. sinense isolates
from different sources in this study provided information on C. nucifera,
H. brasiliensis, E. guineensis, and B. flabellifer plants,
as they were similar strains of the G. sinense. The nucleotide sequences
from specific regions depicted the phylogeny at various taxonomic levels. All
populations were detected as randomly grouped to this study, and they do not
cause geographical distribution. The isolates from the North Sulawesi province
have a genetic relationship close to the North Sumatra Province.
Furthermore, the sequence analysis with BLASTX does not
reflect the numerous same on G. boninense. However, the conjunction
morphology among the different isolates was similar. The comparison of the
genes sequences indicated some translocations and duplications among two G.
sinense and G. boninense fungal species and also revealed many
non-homology genes. It suggested rapid divergent evolution consequent
speciations. Zhu et al. (2015)
reported the genome sequence of G. sinense, one of the most valuable
medicinal fungi such as G. lucidum.
The newly identified conserved DNA of G. boninense
in E. guineensis have been predicted by the homology with some diverse
plant groups (Purba et al. 2019). The
phylogeny is indicated as G. boninense. They did not cluster together
with the identified G. sinense. The present study implied high intra
species diversity or the presence of the gene. The data generated in this study
could be helpful for researchers in studying the conservation of both species.
Mercière et al. (2015) reported that
the mean value identified for N was eight for isolates from Indonesia. It was
not much different in this study. The phylogenetic analysis of the SSR sequence
separated the Ganoderma isolates. It
showed several isolates maybe had been misclassification (Smith and
Sivasithamparam 2000). The bioinformatics method of the DNA identification
isolate the family G. sinense for the species research community is
reported.
We have identified the physical and chemical properties
conserving the DNA belonging to the G. sinense sequences (strain
ZZ0214-1, GenBank Accession number PIL35715.1; PIL26871.1). Experiments confirm
the powerfulness of bioinformatic prediction of DNA. These findings will be
helpful to comprehend the DNA life processes in the Ganoderma pathogen.
Recently, G. lucidum and G. sinense were registered as Lingzhi in
Chinese Pharmacopoeia, which are used to relieve cough and dyspnea (Liu et al. 2009). Many studies reported G.
lucidum as an antitumor activity, but few reports were only focused on G.
sinense (Lin and Zhang 2004; Grace et
al. 2006; Nonaka et al. 2006;
Cheng et al. 2007; Pang et al. 2007).
Table 7: Possibility of the potential transit peptide of Ganoderma
sinense
|
Nucleotide ID |
Reliability |
|||
|
Chloroplast transit
peptide |
Mitochondrial target
peptide |
Signal peptide of secretory pathway |
Reliability prediction |
|
|
BF |
0.119 |
0.089 |
0.057 |
3 |
|
EG |
0.074 |
0.109 |
0.088 |
3 |
|
HB |
0.119 |
0.116 |
0.052 |
3 |
|
RWB |
0.102 |
0.080 |
0.082 |
3 |
|
RWB |
0.110 |
0.075 |
0.079 |
4 |
|
RWB CN EG |
0.085 0.055 0.096 |
0.090 0.069 0.097 |
0.091 0.379 0.072 |
3 5 3 |
BF = Borassus
flabellifer, EG = Elaeis guineensis, HB = Hevea brasiliensis,
RWB = rubber wood block, CN = Cocos nucifera
Table 8: Subcellular localization of the predicted Ganoderma
sinense
|
Protein ID |
Golg |
Cyto |
Plasm |
Perox |
Cyto-Mito |
Cyto- Nucl |
Myto |
Vac |
ER |
Nucl |
Secr |
|
BF |
nd |
8.5 |
nd |
nd |
6.6 |
12.3 |
3.5 |
nd |
nd |
14 |
1.0 |
|
EG |
nd |
8.5 |
nd |
2.0 |
nd |
5.5 |
3.0 |
2.0 |
5.0 |
1.5 |
5.0 |
|
HB |
2.0 |
5.5 |
1.0 |
9.0 |
nd |
6.0 |
4.0 |
nd |
nd |
5.5 |
nd |
|
RWB |
nd |
8.0 |
2.0 |
nd |
nd |
nd |
6.0 |
nd |
nd |
4.0 |
7.0 |
|
RWB |
nd |
6.0 |
4.0 |
nd |
nd |
nd |
4.0 |
nd |
nd |
9.0 |
4.0 |
|
CN EG |
nd nd |
2.0 6.0 |
1.0 1.0 |
nd nd |
nd nd |
nd nd |
2.0 2.0 |
4.0 3.0 |
1.0 nd |
nd 1.0 |
17 14 |
BF = Borassus
flabellifer, EG = Elaeis guineensis, HB = Hevea brasiliensis,
RWB = rubber wood block, CN = Cocos nucifera, Golg = golgi body, Cyto =
cytoplasm, Plasm = plasma membrane, Perox = peroxixom, Cyto – Myto = cytoplasm
– mythochondria, Cyto – Nucl = cytoplasm – nuclear, Myto = mythochondria, Vac =
vacuolar, ER = endoplasmic reticulum, Nucl = nucleolar, Secr = secretary
Eight G. sinense
genes were assessed using bioinformatics analysis, and the clusters were
expected to produce in chloroplast transit peptide (cTP) or mitochondrial
transit peptide (mTP) and were identified from this fungus. An upregulation of
ferredoxin may reflect its direct participation in pathogen defense wherein the
chlorophyll of several photosynthetic proteins is affected by the plant-fungi
interaction in the chloroplast (Konishi et
al. 2001; Castillejo et al.
2004). Bioactive compounds such as the Ganoderic Acid T (GA-T) were predicted
in the mitochondrial of G. lucidum, wherein a triterpenoid exerted
cytotoxicity on various human carcinoma cell (Tang et al. 2006).
Conclusion
Thirteen G. boninense strains
were chosen in the present study in order to identify eight G. sinense strains clustered into two
groups. It was deduced that G. sinense
had genetic diversity in four loci. The data obtained in this study
demonstrated SSR is very sensitive and practical tool to identify the
Ganoderma.
Acknowledgment
A Master
Education towards Doctoral Research supported a part of this work [No.
152/SP2H/LT/DPRM/2018] with approval from the Directorate for Research and
Community Service, Ministry of Research, Technology and Higher Education,
Republic of Indonesia.
References
Altschul SF, TL Madden, AA
Schäffer, J Zhang, Z Zhang, W Miller, DJ Lipman (1997). Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs. Nucl Acids Res 25:3389–3402
Avval SE (2017). Assessing
polymorphism information content (PIC) using SSR molecular markers on local
species of Citrullus colocynthis.
Case study: Iran, Sistan-Balouchestan province. J Mol Biol Res 7:42–49
Basyuni M, R Wati (2017).
Bioinformatics analysis of the oxidosqualene
cyclase gene and the amino acid sequence in mangrove plants. J Phys Conf Ser 801; Article 012011
Basyuni M, R Wati, H Sagami, H
Oku, S Baba (2018a). Bioinformatics approach of three partial polyprenol reductase
genes in Kandelia obovata. J Phys Conf Ser
978; Article 012044
Basyuni M, A Purba, LAP Putri, R
Hayati, D Chalil, I Syahputra (2018b). Bioinformatics analysis of predicted Ganoderma boninense from oil palm (Elaeis guineensis). J Phys Conf Ser 1235;
Article 012071
Basyuni M, R Wati, I Deni, AR
Tia, ES Siregar, I Syahputra (2018c). Cluster analysis of polyisoprenoid in oil
palm (Elaeis guineensis) leaves in
different land-uses to find the possible cause of yield gap from planting
materials. Biodiversitas 19:1492–1501
Bejo KS, CN Vong (2014).
Detection of basal stem rot (BSR) infected oil palm tree using laser scanning
data. Agric Sci Proc 2:156–164
Bhaskaran R (2000). Management
of Basal Stem Rot Disease of Coconut Caused by Ganoderma Iucidum, pp:
121–128. Ganoderma Diseases of Perennial Crops, CABI Publishing, London, UK
Bohnert HJ, P Ayoubi, C Borchert,
RA Bressan, RL Burnap, JC Cushman, MA Cushman, M Deyholos, R Fischer, DW
Galbraith, PM Hasegawa, M Jenks, S Kawasaki, H Koiwa, SK Eda, BH Lee, CB
Michalowski, E Misawa, M Nomura, N Ozturk, B Postier, R Prade, CP Song, Y
Tanaka, H Wang, JK Zhu (2001). A genomics approach towards salt stress
tolerance. Plant Physiol Biochem
39:295–311
Brandfass C, P Karlovsky (2008).
Upscaled CTAB-based DNA extraction and real-time PCR assays for Fusarium culmorum and F. graminearum DNA in plant material
with reduced sampling error. Intl J Mol Sci 9:2306–2321
Buchert GP, OP Rajora, JV Hood, BP
Dancik (1997). Effects of harvesting on genetic diversity in old growth eastern
white pine in Ontario. Conserv Biol 11:747–758
Castillejo MA, N Amiour, ED
Gaudot, D Rubiales, MA Castillejo, N Amiour, E Dumas-Gaudot, E Rubiales, JV
Jorrı́n (2004). A proteomic approach to studying plant response to crenate
broomrape (Orobanche crenata) in pea
(Pisum sativum). Phytochemistry 65:1817–1828
Chee BJ (2005). Ganoderma boninense: Fungus with blood
sugar lowering property. J Trop Med Plants 6:159-164
Cheng KC, HC Huang, JH Chen, JW
Hsu, HC Cheng, CH Ou, WB Yang, ST Chen, CH Wong, HF Juan (2007). Ganoderma lucidum polysaccharides in
human monocytic leukemia cells: from gene expression to network construction. BMC Genomics 9:411-428
Felsenstein J (1985). Confidence
limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791
Gallagher SR, PR Desjardins (2006).
Quantitation of DNA and RNA with absorption and fluorescence spectroscopy. Curr Protoc Mol Biol 93:1-21
Grace GL, KP Fung, GM Tse, PC
Leung, CB Lau (2006). Comparative studies of various Ganoderma species and their different parts with regard to their
antitumor and immunomodulating activities in
vitro. J Altern Compl Med 12:777–789
Hapuarachchi KK, SC Karunarathna,
EHC McKenzie, XL Wu, P Kakumyan, KD Hyde, TC Wen (2019). High phenotypic
plasticity of Ganoderma sinense (Ganodermataceae, Polyporales) in China. Asian J Mycol 2:1–47
Horner DS, G Pavesi, T
Castrignano, PDOD Meo, S Liuni, M Sammeth, E Picardi, G Pesole (2009).
Bioinformatics approaches for genomics and post genomics applications of
next-generation sequencing. Brief
Bioinform 11:181–197
Kandan A, R Bhaskaran, R
Samiyappan (2010). Ganoderma–a basal stem rot disease of coconut palm in south
Asia and Asia pacific regions. Arch Phypathol 43:1445–1449
Konishi H, H Ishiguro, S Komatsu (2001).
A proteomics approach towards understanding blast fungus infection of rice
grown under different levels of nitrogen fertilization. Proteomics 1:1162–1171
Lee PY, J Costumbrado, CY Hsu, YH
Kim (2012). Agarose gel electrophoresis for the separation of DNA fragments. J Visual Exp 62; Article e3923
Lin ZB, HN Zhang (2004).
Anti-tumor and immunoregulatory activities of Ganoderma lucidum and its posssible mechanisms. Acta Pharmacol Sin 25:1387–1395
Liu YW, JL Gao, J Guan, ZM Qian,
K Feng, SP Li (2009). Evaluation of antiproliferative activities and action
mechanisms of extracts from two species of Ganoderma
on tumor cell lines. J Agric Food Chem 57:3087–3093
Marshall DR, AHD Brown (1975). Optimum
Sampling Strategies in Genetic Conservation, pp: 53–80. Cambridge University Press, Cambridge, UK
Mercière M, A Laybats, CC
Lacombe, JS Tan, C Klopp, TD Gasselin, SSRS Alwee, LC Kulandaivelu, F Breton (2015).
Identification and development of new polymorphic microsatellite markers using
genome assembly for Ganoderma boninense,
causal agent of oil palm basal stem rot disease. Mycol Progr 14:103-114
Miller RNG, M Holderness, PD
Bridge, GF Chung, MH Zakaria (1999). Genetic diversity of Ganoderma in oil palm plantings. Plant Pathol 48:595–603
Nasreen Z, T Kausar, M Nadeem, R
Bajwa (2005). Study of different growth parameters in Ganoderma lucidum. Micol Appl
Intl 17:5–8
Nei M (1978). Estimation of
average heterozygosity and genetic distance from a small number of individuals.
Genetics 89:583–590
Nonaka Y, H Shibata, M Nakai, H
Kurihara, H Ishibashi, Y Kiso, T Tanaka, H Yamaguchi, S Abe (2006). Anti-tumor
activities of the antlered form of Ganoderma
lucidum in allogeneic and syngeneic tumor-bearing mice. Biosci Biotechnol Biochem 70:2028–2034
Ogbebor N, A Adekunle, N Eghafona,
A Ogboghodo (2010). Ganoderma
psuedoferreum: biological control possibilities with microorganisms
isolated from soils of rubber plantations in Nigeria. Afr J Agric Res 6:301–305
Pang X, Z Chen, X Gao, W Liu, M
Slavin, W Yao, LL Yu (2007). Potential of a novel polysaccharide preparation
(GLPP) from Anhui-grown Ganoderma lucidum
in tumor treatment and immunostimulation. J
Food Sci 72:435–442
Peakall R, PE Smouse (2012). GenAlEx 6.5: genetic
analysis in Excel. Population genetic software for teaching and research-an
update. Bioinformatics 28:2537-2539
Pearson WR, DJ Lipman (1988).
Improved tools for biological sequence comparison. Proc Natl Acad Sci USA 85:2444–2448
Pilotti CA (2005). Stem rots of oil palm caused by Ganoderma boninense: Pathogen biology
and epidemiology. Mycopathologia
159:129–137
Pilotti CA, FR Sanderson, EA
Aitken, W Armstrong (2004). Morphological variation and host range of two Ganoderma species from Papua New Guinea.
Mycopathologia 158:251–265
Pilotti CA, FR Sanderson, EAB
Aitken (2003). Genetic structure of a population of Ganoderma boninense on oil palm. Plant Pathol 52:455–463
Pop M, SL Salzberg (2008).
Bioinformatics challenges of new sequencing technology. Trends Genet 24:142–149
Purba A, M Basyuni, LAP Putri, D
Chalil, R Hayati, D Arifiyanto, I Syahputra (2019). Sequence analysis of Ganoderma boninense isolates from oil
palm. IOP Conf Ser Earth Environ Sci 260;
Article 012172
Rajendran L, A Kandan, G
Karthikeyan, T Raguchander, R Samiyappan (2009). Early detection of Ganoderma causing basal stem rot disease
in coconut plantations. J Oil Palm Res 21:627–635
Rashid M, MR Choon-Fah, J Bong, A
Khairulmazmi, AS Idris (2014). Genetic and morphological diversity of Ganoderma species isolated from infected
oil palms (Elaeis guineensis). Intl J Agric
Biol 16:691-699
Rees RW, J Flood, Y Hasan, MA
Wills, RM Cooper (2012). Ganoderma
boninense basidiospores in oil palm plantations: evaluation of their
possible role in stem rots of Elaeis
guineensis. Plant Pathol 61:567–578
Sankaran KV, PD Bridge, C
Gokulapalan (2005). Ganoderma diseases of perennial crops in India–an overview.
Mycopathologia 159:143–152
Schoebel CN, S Brodbeck, D
Buehler, C Cornejo, J Gajurel, H Hartikainen, D Keller, M Leys, S Ricanova, G
Segelbacher, S Werth, D Csencsics (2013a). Lessons learned from microsatellite
development for nonmodel organisms using 454 pyrosequencing. J Evol Biol 26:600–611
Schoebel CN, E Jung, S Prospero (2013b).
Development of new polymorphic microsatellite markers for three closely related
plant-pathogenic Phytophthora species
using 454-pyrosequencing and their potential applications. Phytopathology 103:1020–1027
Smith BJ, K Sivasithamparam (2000).
Internal transcribed spacer ribosomal DNA sequence of five species of Ganoderma from Australia. Mycol Res 104:943–951
Tang W, JW Liu, WM Zhao, DZ Wei, JJ
Zhong (2006). Ganoderic acid T from Ganoderma
lucidum mycelia induces mitochondria mediated apoptosis in lung cancer
cells. Life Sci 80:205–211
Thompson JD, DG Higgins, TJ
Gibson (1994). CLUSTAL W: Improving the sensitivity of progressive multiple
sequence alignment through sequence weighting, position-specific gap penalties
and weight matrix choice. Nucl Acids Res
22:4673–4680
Voytas D (2000). Agarose gel
electrophoresis. Curr Protoc Mol Biol
51:2–5
Zakaria L, NS Ali, B Salleh, M
Zakaria (2009). Molecular analysis of Ganoderma
species from different hosts in Peninsula Malaysia. J Biol Sci 9:12–20
Zhao M, W Liang, D Zhang, N Wang,
C Wang, Y Pan (2007). Cloning and characterization of squalene synthase (SQS)
gene from Ganoderma lucidum. J Microbiol Biotechnol 17:1106–1112
Zhu Y, J Xu, C Sun, S Zhou, H Xu,
DR Nelson, J Qian, J Song, H Luo, L Xiang, Y Li, Z Xu, A Ji, L Wang, S Lu, A
Hayward, W Sun, X Li, DC Schwartz, Y Wang, S Chen (2015). Chromosome-level
genome map provides insights into diverse defense mechanisms in the medicinal
fungus Ganoderma sinense. Sci Rep 5; Article 11087